+7 (904) 636-77-16

Mалый практикум по генной инженерии

Mалый практикум по генной инженерии
Т. В. Матвеева, Д. И. Богомаз, Л. А. Лутова

Рекомендовано Учебно-методической комиссией биолого-почвенного факультета Санкт-Петербургского государственного университета в качестве методического пособия для студентов, обучающихся по специальности 020400 — Биология

Матвеева Т. В., Богомаз Д. И., Лутова Л. А. М33 Малый практикум по генной инженерии / Т. В. Матвеева, Д. И. Богомаз, Л. А. Лутова. — СПб : Реноме, 2011. — 52 с. : ил. ISBN 978-5-91918-119-4

В книге обсуждаются основные методы, используемые в генной инженерии, подробно описан генно-инженерный эксперимент, в ходе выполнения которого студенты могут на практике освоить некоторые способы выделения ДНК, различные варианты полимеразной цепной реакции, лигирования, трансформации бактерий, секвенирования. Пособие предназначено для студентов биологических специальностей. Ил. 19, табл. 3, библиогр. 4.

ВВЕДЕНИЕ

Генетическая инженерия (генная инженерия) — совокупность приё- мов, методов и технологий получения рекомбинантных РНК и ДНК, выде ления генов из организма (клеток), осуществления манипуляций с генами и введения их в другие организмы. Чаще всего эксперименты с рекомбинантной ДНК проводят по при- ведённой ниже схеме. Из организма (донора нужных генов) экстрагируют нативную ДНК (клонируемая ДНК), амплифицируют необходимый её участок (или ферментативно фрагментируют её) и соединяют фрагмент (при помо- щи фермента лигазы) с другой ДНК (вектор для клонирования) с об- разованием новой, рекомбинантной молекулы ДНК. Вектор для кло- нирования необходим для успешного переноса и поддержания гена интереса в клетке хозяине. Процесс введения рекомбинантной ДНК в клетку-хозяина (реципиент) называется трансформацией. Далее идентифицируют и отбирают клетки, несущие рекомбинантную ДНК. В большинстве случаев конечной целью работы является синтез спе- цифического рекомбинантного белка клетками-хозяевами, однако генно-инженерные эксперименты могут быть использованы и для из- учения структуры и функционирования последовательностей ДНК. В ходе получения рекомбинантных ДНК их последовательности при- нято периодически проверять. Процесс определения последователь- ности ДНК называется секвенированием.

Основными методами генной инженерии являются полимеразная цепная реакция (ПЦР), рестрикция ДНК, её лигирование и трансфор-

мация бактерий рекомбинантной ДНК. Данный практикум знакомит с указанными методами в ходе постановки цельного генно-инже нер- ного эксперимента. Методическое пособие состоит из двух частей. В первой части даются основные представления о методах генной инженерии. Вторая часть посвящена описанию эксперимента, в ходе которого можно освоить описанные методы.

1. ОСНОВНЫЕ ПРЕДСТАВЛЕНИЯ О МЕТОДАХ ГЕННОЙ ИНЖЕНЕРИИ

1.1. СТРУКТУРА ДНК

Поскольку генно-инженерные эксперименты — это манипуляции с молекулой ДНК, остановимся немного подробнее на её структуре. Дезоксирибонуклеиновая кислота (ДНК) — один из двух типов нук- леиновых кислот, обеспечивающих хранение, передачу из поколения в поколение и реализацию генетической информации о функциони- ровании живых организмов. Основная роль ДНК в клетках — долго- временное хранение информации о структуре РНК и белков. С химической точки зрения ДНК — это полимер, состоящий из мономеров-нуклеотидов. Каждый нуклеотид состоит из азотистого основания, сахара (дезоксирибозы) и фосфатной группы (рис. 1).

Структура нуклеотида Рис. 1. Структура нуклеотида

В ДНК встречается четыре вида азотистых оснований (аденин, гуа- нин, тимин и цитозин) (рис. 2). Связи между нуклеотидами в цепи об- разуются за счёт дезоксирибозы и фосфатной группы.

Азотистые основания, входящие в состав ДНК

Рис. 2. Азотистые основания, входящие в состав ДНК

При описании нуклеиновых кислот атомы углерода в азотистых основаниях принято нумеровать цифрами, а в пентозе — цифрами со штрихом. К 3’-углероду дезоксирибозы присоединена ОН-группа. За счёт этой группы и одной из кислотных групп остатка фосфорной кислоты, присоединённого к 5’-углероду, образуется фосфодиэфир- ная связь. В результате получается цепочка, показанная на рис. 3. Как видно из рисунка, на одном конце цепочки находится свободная фос- фатная группа при пятом атоме пентозы, на другом — пентоза со сво- бодной ОН-группой при третьем атоме углерода. Так что в данном слу- чае принято говорить о 5’- и 3’-концах молекулы, причём первый считается началом цепочки ДНК, а второй — концом.

Цепь ДНК Рис. 3. Цепь ДНК

В подавляющем большинстве случаев ДНК состоит из двух цепей, ориентированных азотистыми основаниями друг к другу. Азотистые основания одной из цепей соединены с азотистыми основаниями дру- гой цепи водородными связями согласно принципу комплементар- ности: аденин соединяется только с тимином, гуанин — только с цито- зином. Эта двухцепочечная молекула спирализована. При этом цепи являются антипараллельными, т. е. 5’-конец одной цепи находится на- против 3’-конца другой цепи. Последовательность нуклеотидов позво- ляет «кодировать» информацию о различных типах РНК, наиболее важ- ными из которых являются информационные, или матричные (мРНК), рибосомальные (рРНК) и транспортные (тРНК). Все эти типы РНК синте- зируются на матрице ДНК за счёт копирования последо вательности ДНК в последовательность РНК. Общепринятой формой записи после- довательности ДНК является запись нуклеотидов от 5’- к 3’-концу. При нагревании ДНК водородные связи разрываются, и нити в двойной спирали расплетаются. Процесс нагревания называется плавлением ДНК, при этом разрушаются связи между парами А — Т и Г — Ц. Чем больше в ДНК пар А — Т, тем менее прочно нити связаны друг с другом, тем легче ДНК расплавить.

1.2. ПОЛИМЕРАЗНАЯ ЦЕПНАЯ РЕАКЦИЯ

Полимеразная цепная реакция (ПЦР) — экспериментальный метод молекулярной биологии, основанный на многократной ферментатив- ной амплификации целевого фрагмента ДНК, фланкированного синте- тическими олигонуклеотидами. Полимеразную цепную реакцию (ПЦР, PCR) изобрёл в 1983 году американский учёный Кэри Мюллис. Впоследствии он получил за это изобретение Нобелевскую премию. В основе метода ПЦР лежит мно- гократное удвоение выбранного исследователем участка ДНК. В ре- зультате нарабатываются количества ДНК, достаточные для визуаль- ной детекции. Помимо амплификации ДНК, ПЦР позволяет производить мно- жество других манипуляций с нуклеиновыми кислотами (введение му таций, сращивание фрагментов ДНК) и широко используется в би о- логической и медицинской практике, например, для диагностики заболеваний (наследственных, инфекционных), установления отцов- ства, клонирования генов, выделения новых генов. Для того чтобы провести ПЦР, в микроцентрифужной пробирке смешивают ДНК-матрицу, праймеры (ДНК-затравки), нуклеотиды, ДНК- полимеразу, буфер для фермента. Реакция идёт в водном растворе. Праймеры — это небольшие фрагменты одноцепочечной ДНК, комплементарные участкам разных цепей матрицы, расположенным на небольшом (обычно 100–2000 п. н.) расстоянии друг от друга (рис. 4).

Как правило, праймеры представляют собой последовательности длиной 20–24 нуклеотида. При этом рекомендуют подбирать их таким образом, чтобы их ГЦ-состав (процент гуанина и цитозина) составлял от 40 до 60%. Праймеры получают путём химического синтеза. В боль- шинстве случаев генные инженеры самостоятельно подбирают по- следовательности праймеров, а их синтез заказывают в биотехнологи- ческих фирмах. Важно учитывать тот факт, что обычно химически синтезированные фрагменты ДНК (в отличие от природных) на 5’-кон- це не имеют фосфата. Реакция ПЦР состоит из нескольких десятков циклов, в ходе каждо- го из которых выделяют три этапа. Первый этап — денатурация ДНК. Он осуществляется при нагрева- нии реакционной смеси до +93 – +95° С. На этом этапе разрываются водородные связи между азотистыми основаниями. Как следствие, цепи ДНК перестают удерживаться друг около друга.

Расположение праймеров на ДНК-матрице.png

Рис. 4. Расположение праймеров на ДНК-матрице

Второй этап — отжиг праймеров. Важнейшая характеристика прай- меров — температура плавления (Tm) комплекса праймер-матрица. Она определяется как температура, при которой половина сайтов свя- зывания праймера занята. Tm можно приблизительно определить по формуле: Tm = 2(A + T) + 4(G + C). Если праймер короткий, а Tm мала, то праймер может оказаться частично комплементарен другим участкам матричной ДНК, что может привести к появлению неспецифических продуктов. Сверху температура плавления ограничена оптимумом действия полимеразы. Третий этап — элонгация (удлинение цепочки ДНК). После гибри- дизации матрицы с праймером (отжиг) последний служит затравкой для ДНК-полимеразы при синтезе комплементарной цепи матрицы (рис. 5).

Стадии одного цикла ПЦР.png

Рис. 5. Стадии одного цикла ПЦР

В ходе одного цикла ПЦР количество фрагмента, ограниченного мес тами отжига праймеров увеличивается в два раза. За N циклов реакции количество амплифицируемого фрагмента увеличивается в 2N раз. В настоящее время в ПЦР в подавляющем большинстве случаев ис- пользуют ДНК-полимеразу термофильной бактерии Thermus aquaticus (Taq-полимераза), выделенную и охарактеризованную в 1980 году совет скими учёными А. С. Калединым, А. Г. Слюсаренко и С. И. Городец- ким из ВНИИ генетики. Температурный оптимум реакции, направля е- мой Taq-полимеразой, находится в районе +70° С. Другим важным свойством является то, что данная полимераза не инактивируется по- сле длительной инкубации при +95° С. Используя Taq-полимеразу, уда- лось решить сразу две проблемы. Во-первых, термостабильная поли- мераза не инактивируется на этапе денатурации ДНК, поэтому нет необходимости после каждого цикла реакции добавлять новую пор- цию фермента. Это упрощение процедуры позволило автоматизиро- вать проведение ПЦР, так как теперь требовалось лишь перенести об- разец с определённым интервалом времени в разные температурные условия: +90 – +95° С (температура денатурации) и +50 – +72° С (темпе- ратура ренатурации ДНК и ферментативной реакции). Во-вторых, вы- сокий температурный оптимум реакции, катализируемой Taq- полимеразой, позволяет подбирать жёсткие температурные условия отжига, обеспечивающие гибридизацию праймеров только в задан- ном районе изучаемого генома, что существенно повышает специфич- ность и чувствительность метода. Однако у Taq полимеразы есть и свои недостатки, например, сравнительно низкая точность, а также способность добавлять аденозинмонофосфаты к 3’-концу ДНК. Кроме Taq полимеразы в настоящее время используют и другие термостабильные полимеразы. В частности, это термостабильная по- лимераза Pfu из Pyrococcus furiosus, характеризующаяся высокой точ- ностью и синтезом фрагментов с тупыми концами. Продукты реакции разделяют в агарозном геле и визуализируют, окрашивая бромистым этидием. Бромистый этидий, взаимодействуя с ДНК, приводит к её флуоресценции при облучении ультрафиолето- вым светом. В генной инженерии ПЦР используют для амплификации фрагмен- тов ДНК, на основе которых получают рекомбинантные молекулы, а также для контроля присутствия целевой последовательности ДНК в исследуемых образцах. Кроме классических вариантов ПЦР в современной молекулярной биологии используют ПЦР в реальном времени. Эта группа методик основана на использовании флуоресцентных красителей, интенсив- ность свечения которых (репортёрная флуоресценция) пропорцио- нальна количеству образуемого продукта ПЦР. Такой подход даёт воз- можность опосредованно оценить выход продукта реакции после каждого цикла амплификации, построить по полученным данным ки- нетическую кривую ПЦР и определить относительную концентрацию субстрата на основании анализа этой кривой. Амплификаторы для ПЦР в реальном времени снабжены оптиче- ским блоком. Его функцией является облучение пробирок, в которых идёт ПЦР, светом определённой длины волны и детекция испускаемой образцами флуоресценции в другой области спектра в ходе реакции. Большинство современных амплификаторов для ПЦР в реальном вре- мени имеют четыре-пять флуоресцентных каналов. Существует две разновидности ПЦР в реальном времени, различающиеся по природе генерирования репортёрной флуоресценции. Первая разновидность основана на использовании интеркалирую- щих красителей. Наиболее распространённым среди них является SYBR Green. Этот краситель — исключительно чувствительный флуо- ресцентный индикатор двухцепочечной ДНК. Иными словами, интен- сивность свечения красителя тем выше, чем больше в пробе концен- трация двунитевой ДНК. Максимум флуоресценции в комплексе с ДНК составляет 521 нм, максимум возбуждения — 497 нм. Вторая разновидность ПЦР в реальном времени основана на ис- пользовании флуоресцентно-меченых зондов. Наиболее распростра- нённым типом зондов являются зонды Taqman. Они содержат на одном конце флуоресцентный краситель, а на другом — гаситель флуоресценции. Зонды должны быть подобраны так, чтобы они отжи- гались на ДНК-матрицу между сайтами отжига праймеров, а темпера- тура плавления зондов должна быть приблизительно на 10° С выше, чем праймеров. Действие зондов основано на том, что изначально флуоресцен ция красителя подавляется гасителем флуоресценции, находящимся достаточно близко (в составе одного зонда). В ходе ре- акции зонд отжигается между праймерами. Taq-полимераза обладает 5’-3’-экзонуклеазной активностью. В ходе наращивания цепи она на- тыкается на препятствие в виде зонда и начинает гидролизовать его. В результате флуоресцентный краситель и гаситель флуоресценции оказываются разобщёнными. Краситель начинает светиться (рис. 6). Итак, чем больше ПЦР-продуктов образуется, тем больше зондов гидролизуется, тем выше становится уровень флуоресценции. Чем

Схема одного цикла ПЦР в реальном времени с зондом TaqMan.png

Рис. 6. Схема одного цикла ПЦР в реальном времени с зондом TaqMan

раньше прибор начинает детектировать рост флуоресценции, тем больше матрицы для ПЦР присутствовало в образце. Кинетическая кривая PCR в координатах «Уровень репортёрной флуоресценции — цикл амплификации» имеет сигмовидную форму (рис. 7). В ней можно выделить три стадии: 1. стадию инициации (когда ПЦР-продукты ещё не детектируется флуоресцентной меткой); 2. экспоненциальную стадию (в которой наблюдается экспоненци- альная зависимость увеличения интенсивности флуоресценции от цикла ПЦР); 3. стадию насыщения, характеризующуюся снижением эффектив- ности реакции с постепенным выходом на плато.

Кинетическая кривая PCR в координатах.png

Рис. 7. Кинетическая кривая PCR в координатах

«Уровень репортёрной флуоресценции — цикл амплификации». 1 — стадия инициации, 2 — экспоненциальная стадия, 3 — плато. Координаты по оси абсцисс точек пересечения графиков с линией Со соответствуют значениям пороговых циклов

Важным параметром ПЦР в реальном времени является значение порогового (Со) цикла. Проще всего его определить как цикл, начиная с которого происходит регистрация накопления продуктов амплифи- кации. Исходное количество ДНК-мишени пропорционально значе- нию порогового цикла. В идеальном случае, если в образце 1 концен- трация ДНК мишени выше в два раза, чем в образце 2, то значение порогового цикла образца 1 будет на единицу меньше, чем для образ- ца 2. Это связано с тем, что в ходе каждого цикла происходит удвоение продуктов реакции. Следовательно, в идеальном случае, если значе- ния пороговых циклов между образцами отличаются на величину N, то количество исходной ДНК-мишени различалось в 2N раз. В генной инженерии ПЦР в реальном времени используют, как пра- вило, для количественной оценки экспрессии трансгенов.

1.3. РЕСТРИКЦИЯ

Рестрикцией называют разрезание цепочки ДНК, осуществляемое специальным ферментом (рестриктазой). Рестриктазы (рестрицирующие эндонуклеазы, эндонуклеазы ре- стрикции) — это группа ферментов, относящихся к классу гидролаз, катализирующих реакцию гидролиза нуклеиновых кислот. В отличие от экзонуклеаз, рестриктазы расщепляют нуклеиновые кислоты не с конца молекулы, а в середине. При этом каждая рестриктаза узнаёт определённый участок ДНК длиной от четырёх пар нуклеотидов и расщепляет нуклеотидную цепь внутри участка узнавания или за его пределами. В зависимости от симметричности сайта узнавания и местополо- жения разреза относительно сайта узнавания эндонуклеазы рестрик- ции подразделяют на три основных типа (или класса). В генной ин- женерии активно используют рестриктазы второго типа, поскольку в отличие от остальных они узнают последовательности, обладающие симметрией второго порядка, и делают разрез в пределах сайта узна- вания. Это важно, поскольку при молекулярном клонировании нужно, чтобы расщепление донорной и векторной ДНК происходило в строго определённых участках (сайтах) с образованием дискретного и вос- производимого набора фрагментов.

Названия рестриктазам даются по следующему принципу: род ми- кроорганизма обозначается первой прописной буквой ( E coRI), а вид — двумя строчными (E co RI); иногда указывают штамм в виде заглавной буквы (Eco R I). Римские цифры (EcoR I ) — это порядковый номер дан- ной эндонуклеазы в ряду прочих рестриктаз, выделенных из данного микроорганизма. Например, HраI и НраII — соответственно первая и вторая рестрицирующие эндонуклеазы типа II, выделенные из Haemo- philus parainfluenzae. Рестриктазы II типа узнают последовательности двухцепочечной ДНК длиной 4–8 п. н., имеющие ось симметрии второго порядка — палин дромы (рис. 8).

Схема палиндрома ДНК.png

Рис. 8. Схема палиндрома ДНК

Как видно из рисунка, последовательность при повороте её на 180 градусов относительно оси, указанной точкой, совпадёт с исход- ной. От длины сайта узнавания зависит частота его распространения в моле куле ДНК; в большинстве случаев используют рестриктазы, узнающие тетра- и гексануклеотиды. При этом часть рестриктаз рас- щепляет ДНК строго по оси симметрии, что приводит к образованию фрагментов ДНК с тупыми концами, не имеющими выступающих одно- цепочечных участков (HaeIII, SmaI). Другие, например EcoRI и PstI, вно- сят разрыв не точно по оси симметрии второго порядка, а в точках двух цепей ДНК, отстоящих друг от друга на четыре нуклеотида. В ре- зультате такого разрыва образуются фрагменты ДНК с выступающими липкими 5’-концами (EcoRI) или 3’-концами (PstI) (рис. 9).

Тупые и липкие концы, образующиеся в результате рестрикции.png

Рестриктазы являются ферментами, активность которых зависит от состава реакционной смеси и температуры проведения реакции. Фирмы, выпускающие рестриктазы, поставляют и буферные растворы, которые отличаются по рН, концентрации и ионной силе. Для ос- новной массы рестриктаз можно использовать один из выпус каемых буферов. Все необходимые характеристики фермента при водятся на этикетке, в том числе там указывают активность фермента в разных бу ферах. Их несколько типов. Некоторые рестриктазы могут рабо- тать в одном и том же буфере. В этом случае с ними можно ставить со- вместную рестрикцию. Если рестриктазы требуют использования разных буферов, то рестрикцию надо проводить последовательно: сначала рестрицировать одним ферментом, потом пере осадить про- дукты рестрикции, затем поставить реакцию с другой рестриктазой. Оптимальной температурой реакции для большинства рестриктаз является +37° С, однако существуют рестриктазы, работающие при бо- лее низкой (SmaI предпочитает +25° С) и более высокой температуре (BclI — +50° С, рестриктазы, выделенные из термофильных микроор- ганизмов, например, BsaBI — +60° С, BsmI — +65° С). Необходимо помнить, что объём добавляемого фермента не дол- жен превышать 1/10 объёма реакционной смеси, поскольку избыток глицирина, входящего в состав буфера для хранения фермента, может ингибировать реакцию.

Некоторые рестриктазы при работе в неоптимальных условиях могут менять свою специфичность. Это называется Star-активностью и отмечается звёздочкой. Например, EcoRI при повышении рН и умень- шении ионной силы буфера вместо последовательности 5’-G AATTC-3’ узнаёт последовательность 5’- N AATTN-3’.

Рис. 9. Тупые и липкие концы, образующиеся в результате рестрикции

Обычно разные рестриктазы узнают разные последовательности. Однако иногда ферменты, выделенные из разных источников, узна- ют одинаковые последовательности и разрезают их одинаково. Та- кие ферменты называются изошизомерами. Например, BamHI и BstI (G/GATCC), SphI, PaeI, BbuI (GCATG/C). В некоторых случаях рестрикта- зы узнают одну и ту же последовательность, но разрезают в разных местах — SacI (GAGCT/C) и Ecl136I (GAG/CTC). Это гетерошизомеры. Существуют рестриктазы, которые при расщеплении ДНК образу- ют одинаковые выступающие липкие концы. Когда два образца ДНК обрабатывают разными рестриктазами с образованием фрагментов с одинаковыми липкими концами, а затем смешивают эти образцы, то, благодаря комплементарному спариванию липких концов фрагмен- тов разных образцов, могут образовываться новые комбинации ге- нов. Для полного воссоединения концов ДНК используют лигазы, кото рые будут рассмотрены в следующем разделе. В генной инженерии рестриктазы используют на первом этапе соз- дания рекомбинантных ДНК (для подготовки молекул ДНК к последу- ющему лигированию), а также для проверки структуры рекомбинант- ной ДНК (рестрикционное картирование).

1.4. ЛИГИРОВАНИЕ ГЕНА ИНТЕРЕСА В ВЕКТОР

Лигирование ДНК — то ковалентное сшивание цепей ДНК в ду- плексе при репликации, репарации и рекомбинации. Процесс катали- зируют ферменты-лигазы, которые образуют фосфодиэфирные мости- ки между 5’-фосфорильной и 3’-гидроксильной группами соседних дезоксинуклеотидов в местах разрыва ДНК или между двумя молеку- лами ДНК. В генной инженерии лигирование — приём, с помощью ко- торого чужеродная ДНК встраивается в вектор. В качестве источника ДНК для встраивания в вектор могут служить продукты ПЦР, рестрикции или (реже) продукты неферментативной фрагментации ДНК. В генной инженерии используют ДНК-лигазы E.сoli и фага Т4. Они различаются по потребности в кофакторах — NAD+ (в случае лигазы E.coli) и ATP (фаговая лигаза). ДНК-лигаза фага Т4 катализирует «сши- вание» как липких, так и тупых концов. ДНК-лигаза E.сoli не способна лигировать тупые концы. Поэтому в экспериментах по клонированию в подавляющем большинстве случаев использют ДНК-лигазу фага Т4. Важно понимать, что клонирование фрагментов, полученных при помощи ПЦР, отличается от клонирования фрагментов, полученных в ходе рестрикции. Воссоединение фрагментов возможно в случае существования 5’-фосфорильной группы на конце одного фрагмента и 3’-гидроксиль- ной группы на конце другого фрагмента. Продукты ПЦР не имеют фос- фата на 5’-конце, поэтому не могут быть залигированы друг на друга, а при их лигировании с фрагментами, имеющими 5’-фосфатные груп- пы, образуются молекулы с однонитевыми брешами. В простейшем случае в генно-инженерных экспериментах лигиру- ют ген интереса в молекулу-вектор. В более сложных случаях реком- бинантные ДНК собирают из множества частей. Такой эксперимент проводят в несколько этапов. Для клонирования фрагментов ДНК используют различные векто- ры, различающиеся по структуре и размерам, но все они должны об- ладать следующими общими свойствами:

  • способностью к автономной репликации в реципиентных клетках при наличии встройки чужеродной ДНК;
  • стабильностью в реципиентных клетках;
  • стабильным поддержанием чужеродной ДНК;
  • наличием уникальных сайтов рестрикции, по которым можно встраивать чужеродную ДНК и которые расположены в области, несущественной для амплификации вектора (удобно, если эти сайты находятся в селективных генах);
  • наличием селективных маркеров, позволяющих идентифицировать клетки, содержащие рекомбинантную ДНК;
  • относительно небольшим размером, позволяющим легко от делять рекомбинантную ДНК от хромосомной ДНК реципиентной клетки.

Выбор вектора зависит от того, какого размера фрагмент плани- руется клонировать. Для очень протяжённых фрагментов — более 100 т. п. н. используют так называемые искусственные хромосомы ( ВАС , bacterial artificial chromosomes), YAC (yeast artificial chromosomes). Для фрагментов размером несколько десятков т. п. н. применяют дру- гие векторы. Векторы на основе фага лябмда предназначены для кло- нирования фрагментов размером 20 т. п. н. Векторы, имеющие черты фага лямбда и плазмид, — космиды используют для клонирования фрагментов размером около 40 т. п. н. Наиболее распространёнными являются плазмидные векторы. В них можно заклонировать фрагменты размером несколько т. п. н. Большие вставки ДНК в векторных плазмидах нестабильны, а клони- рование фрагментов ДНК больше 10 т. п. н. резко снижает эффектив- ность последующей трансформации. В настоящее время для облегчения отбора клонов со вставками используют селективные системы. Классическим примером такой си- стемы является бело-голубая селекция, реализованная в векторах се- рии pUC, разработанных в Калифорнийском университете (рис. 10).

Схема работы лактозного оперона.png

Рис. 10. Схема работы лактозного оперона

В состав векторов входит регуляторная часть lас-оперона: ген реп- рессора laсI и 5’-концевая часть структурного гена β-галактозидазы E.coli — lacZ’, кодирующая так называемый альфа-пептид β-галак- тозидазы, состо ящий из 145 аминокислот. Этот пептид способен in vivo вза имодействовать с С-концевой частью полипептида без образова- ния пептидной связи и восстанавливать ферментативную ак тивность (α-комплементация). В результате трансформации плазмидой pUC клеток, имеющих частичную делецию начальной части гена lacZ (Δ11– 41 аминокислоты), происходит изменение их фенотипа от Lac− к Lac+. β-галактозидаза обладает способностью расщеплять субстрат Xgal (5-бром-4-хлор-3-индолил-бета-D-галактопиранозид) с образованием окрашенного в голубой цвет продукта реакции. Поэтому колонии Lac+ клеток, несущих плазмиду pUC, на среде с Xgal и индуктором lас- оперона IPTG (изопропилтиогалактозид), инактивирующим репрес- сор, окрашены в голубой цвет. Уникальные сайты рестрикции для клонирования ДНК локали- зованы в начале гена β-галактозидазы в составе полилинкера (после- довательности нуклеотидов, содержащей несколько перекрываю- щихся уникальных сайтов рестрикции). Интеграция чужеродной ДНК в последовательность полилинкера нарушает рамку считывания гена β-галактозидазы и инактивирует фермент, в связи с чем колонии кле- ток, несущие рекомбинантную плазмиду, на питательной среде с Xgal, бесцветны. Поскольку векторы серии pUC содержат ген устойчиво- сти к ампициллину, отбор бактерий, несущих рекомбинантные плаз- миды, можно проводить одновременно по двум маркерам. На пита- тельной среде с ампициллином и Xgal вырастают только бактерии, устойчивые к антибиотику, т. е. содержащие плазмиду pUC, а среди выросших колоний лишь неокрашенные будут содержать вставку чуже родной ДНК. Еще более удобным является вектор pJET 1.2, сконструированный фирмой Fermentas на основе вектора pUC19. Он был получен заменой 5’-концевой части гена LacZ геном, кодирующим рестриктазу Eco47I. В отсутствие соответствующего метилирования ДНК, эндонуклеаза яв- ляется летальной для клеток E.coli хозяина. В гене этой эндонуклеазы находится полилинкер, содержащий в том числе сайт для тупощепя- щей рестриктазы EcoRV. Коммерческий продукт представляет собой набор для клонирования, ключевым компонентом которого является вектор pJET1.2, вскрытый по сайту EcoRV. В этот вектор могут быть за- клонированы продукты ПЦР. После трансформации на среде с анти- биотиком будут вырастать только клетки с плазмидой, содержащей вставку. В плазмидах без вставки восстанавливается структура гена эндонуклеазы, начинает вырабатываться токсичный для клетки белок, клетка гибнет. Поскольку технически многие операции с рекомбинантными ДНК сложнее проводить в клетках эукариот, чем прокариот, большинство эукариотических векторов сконструированы как челночные. Иными словами, эти векторы несут два типа сайтов инициации репликации и два типа селективных маркерных генов, одни из которых функциони- руют в Escherichia coli, a другие — в эукариотических хозяйских клет- ках. Такие векторные системы экспрессии разработаны для дрожжей, насекомых и клеток млекопитающих.

1.5. ТРАНСФОРМАЦИЯ

Процесс внесения ДНК в клетки бактерий называется трансфор- мацией. Способностью эффективно поглощать ДНК обладают только компетентные клетки. В генной инженерии применяют два типа ме- тодик трансформации: химическую трансформацию и электропора- цию. Химически компетентные клетки характеризуются изменением свойств клеточной оболочки (уменьшается поверхностный заряд, по- вышается чувствительность к осмотическому шоку и т. д.). Для получе- ния компетентных клеток используют специально разработанные приёмы (обрабатывают бактериальные клетки хлористым кальцием), которые обратимо повышают проницаемость клеточной оболочки. Электропорация — создание пор в бислойной липидной мембране под действием электрического поля. Это явление используется в био- технологии для внедрения макромолекул (ДНК или РНК) в клетки жи- вых организмов. Явление электропорации основано на том, что при воздействии на клетки электрическим полем высокого напряжения происходит локальная деполяризация участков мембраны, сопрово- ждающаяся образованием пор. Как правило, к суспензии клеток в дис- тиллированной воде прикладывают импульсы электрического поля с напряжённостью от нескольких сотен до нескольких тысяч вольт на сантиметр и длительностью от десятков микросекунд до десятков миллисекунд. Данная процедура проводится с использованием спе- циального прибора — электропоратора по протоколам, прилагаемым к нему. Получение электрокомпетентных клеток сводится к отмывке культуры клеток от солей. Существенное значение для эффективности трансформации имеет структура вектора. Наиболее эффективно трансформируют ковалент- но замкнутые кольцевые молекулы. Использование открытых колец (получающихся в результате однонитевых разрывов ДНК и снятия супер спирализации ДНК) снижает эффективность трансформации при- мерно в два раза. Линеаризованные плазмидные ДНК сохраняют 0,1– 10% трансформирующей активности. Эффективность трансформации невысокая, обычно трансформи- руется не более одной клетки из тысячи. После создания рекомбинантных молекул и отбора бактериальных клонов, содержащих их, рекомбинантные молекулы принято прове- рять секвенированием.

1.6. СЕКВЕНИРОВАНИЕ

Секвенирование — это определение нуклеотидной последова- тельности ДНК. Для секвенирования ДНК в настоящее время исполь- зуют дидезоксинуклеотидный метод, или метод «обрыва цепи», раз- работанный Ф. Сенгером в 1977 году. Как и классический вариант Сенгера, современное автоматическое секвенирование включает две стадии: проведение терминирующих реакций и разделение продук- тов этих реакций с помощью электрофореза. Как правило, автомати- зирована лишь вторая стадия, т. е. разделение меченых фрагментов ДНК в ПААГ (полиакриламидном геле), получение спектра эмиссии флуорофоров и последующий обсчёт собранных данных. При дидезокси-секвенировании происходит гибридизация синте- тического олигонуклеотида длиной 17–20 звеньев со специфическим участком одной из цепей секвенируемого фрагмента. Этот олигонук- леотид является праймером, поставляющим 3’-гидроксильную группу для инициации синтеза цепи, комплементарной матрице. Кроме ма- трицы и праймера в реакционную смесь добавляют ДНК-полимеразу, нуклеотиды (dNTP) и дидезоксинуклеотиды ddATP, ddTTP, ddGTP или ddCTP, каждый из которых мечен своей флуоресцентной краской. Если дидезоксинуклеотид включается в растущую цепь, рост цепи сразу останавливается. Это происходит ввиду отсутствия группы 3’-ОН, необходимой для роста цепи ДНК (рис. 11). В результате этого

Схема блокирования синтеза цепи ДНК при помощи ddNTP.png

Рис. 11. Схема блокирования синтеза цепи ДНК при помощи ddNTP

в пробирке при участии ДНК-полимеразы образуется уникальный набор олигонуклеотидов разной длины, включающих праймерную по- следовательность и один из четырёх типов флуоресцентной метки (свой для каждого ddNTP). Далее в пробирки добавляют формамид для расхож дения цепей и проводят электрофорез. Во время электрофоре- за в полиакриламидном геле луч лазера автоматического секвенатора в определённом месте геля возбуждает флуоресценцию красителей, и детектор определяет, какой нуклеотид терминировал цепь, мигрирующую в настоящий момент через гель. Современные при боры исполь- зуют для секвенирования ДНК капиллярный электрофорез, разделение продуктов сиквенсной реакции в котором, происходит в тончай ших трубках (капиллярах), заполненных полужидкой полиакриламидной матрицей. Результаты секвенирования выводятся на экран компьюте- ра и могут быть сохранены в виде графического файла, представляю- щего собой последовательность пиков четырёх цветов (рис. 12), соот- ветствующих четырём нуклеотидам. Данная информация дублируется буквенным обозначением нуклеотидной последовательности.

Схема представления сиквенса автоматическим секвенатором.png

Рис. 12. Схема представления сиквенса автоматическим секвенатором

Секвенирование — это метод, который должен быть использован на разных этапах генно-инженерного эксперимента: от выяснения пер- вичной структуры гена интереса до подтверждения соответствия при- внесённой последовательности, ожидаемой в трансгенном организме. В настоящее время для анализа сиквенсов существует множество компьютерных программ, большинство из которых имеется в свобод- ном доступе в сети Интернет. Многие из них можно найти на сайте http://www.ncbi.nlm.nih.gov/. Так, алгоритм BLAST позволяет сравни- вать последовательности между собой, в том числе находить сиквен- сы, имеющие сходство с запрашиваемым, в базах данных известных на сегодняшний день последовательностей. Итак, мы кратко рассмотрели принципы и сферу применения мето- дов генной инженерии. Обратимся теперь к их практическому освое- нию в рамках одного целостного эксперимента, посвящённого анали- зу видового состава сложной биологической смеси.

2. ПРАКТИЧЕСКАЯ РАБОТА

2.1. ПОСТАНОВКА ЗАДАЧИ ЭКСПЕРИМЕНТА

Предлагаем познакомиться с методами генной инженерии, выпол- нив исследование на тему «Анализ состава фарша мясных полуфабри- катов генно-инженерными методами». Задача исследования: выяснить, какие компоненты, кроме мяса, использованы при приготовлении мясного фарша, методами анализа оставшихся в нём фрагментов ДНК. В основе работы будет лежать ана- лиз таксономически значимых районов последовательностей ДНК, которые будут подвергнуты клонированию и секвенированию. В настоящее время одними из наиболее популярных таких марке- ров являются последовательности внутренних транскрибируемых спейсеров рибосомальных генов (ITS internal transcribed spacer). Мо- тив ITS локализуется между структурными генами рибосомальной РНК 18S-5,8S-26S. Рибосомальные гены представляют собой единый кластер ядерных генов, организованный в виде тандемно располо- женных повторов. Каждый кластер рибосомальных генов состоит из транскрибируемой области (гены 18S, 5,8S и 26S рРНК) и внутренних транскрибируемых спейсеров, расположенных по обе стороны от 5,8S рРНК, эти спейсеры называются ITS1 и ITS2 (рис. 13). Предполагается, что ITS, как любые некодирующие последователь- ности, накапливают мутации с высокой скоростью. Следовательно, они могут сильно отличаться даже у близкородственных организмов, поэтому их используют для филогенетических и биогеографических исследований. Вместе с тем гены рибосомальных РНК, напротив, доста- точно консервативны. Поэтому на основе их последовательности мо- гут быть созданы универсальные праймеры, амплифицирующие ДНК широкого круга организмов. В настоящее время распространено ис- пользование праймеров, комплементарных участкам генов 18S РНК и 26S РНК, прилежащих к ITS1 и ITS2. С их помощью можно амплифици- ровать фрагмент, содержащий ITS1-ген 5, 8S РНК-ITS2. Это можно сде- лать, в том числе, и на смеси ДНК разных видов, но потом для анализа отдельных последовательностей необходима стадия клонирования.

Схема организации кластера рибосомальных генов.png

Рис. 13. Схема организации кластера рибосомальных генов (стрелками указано расположение праймеров, используемых для амплификации кластера ITS)

Итак, для решения нашей задачи предлагается выполнить эксперимент по схеме, представленной на рис. 14.

Схема эксперимента.png

Рис. 14. Схема эксперимента

Приступим к описанию его этапов.

2.2. ЭТАП 1. ВЫДЕЛЕНИЕ ГЕНОМНОЙ ДНК

Необходимое оборудование: водяная баня (нагретая до +56°^ С), центрифуги, дозаторы, фарфоровые ступки и пестики. Расходные материалы: микроцентрифужные пробирки на 1,5 мл, наконечники для дозаторов на 1 мл, 200 мкл. Растворы: 1. экстрагирующий буфер 2. этанол 70% 3. хлороформ 4. изопропанол.

Ход работы:

Приготовление экстрагирующего буфера. В колбе смешать: 2 г ЦТАБ (цетилтриметиламмоний бромид), англ. CTAB (детергент, разрушает клеточные мембраны, образует комплексы с белка- ми и кислыми полисахаридами), 28 мл 5M NaCl, 4 мл 0,5M ЭДТА (этилендиаминтетрауксусная кислота), англ. EDTA, pH 8, 5 мл 2M Трис — HCl (гидроксиметил аминометан гидрохлорид), англ. Tris — HCl (2-Amino-2-hydroxymethyl-propane-1,3-diol hy- drochloride), pH 8. Довести дистиллированной водой до 100 мл.

Процедура выделения ДНК.

  1. 0,5 г ткани поместить в ступку, тщательно растереть с помощью пестика с 1 мл экстрагирующего буфера.
  2. Перенести материал в микроцентрифужную пробирку объёмом 1,5–2 мл на 56–60º С на 30–40 минут, периодически перемешивая содержимое пробирки.
  3. После инкубации добавить равный объём хлороформа и оставить на 30–40 минут при комнатной температуре. Содержимое пробирки постоянно перемешивать.
  4. Центрифугировать в течение 5 минут при 3000 об./мин.
  5. Перенести верхнюю фазу в чистую пробирку и добавить 2/3 объёма изопропилового спирта, перемешать. Пробирки с содержимым оставить при комнатной температуре на 20–30 минут (можно дольше)для осаждения ДНК.
  6. Центрифугировать 10 минут при максимальных оборотах (10000 об./мин). Супернатант слить и промыть осадок 70%-ным этиловым спиртом. Центрифугировать при тех же условиях.
  7. Супернатант слить, осадок нуклеиновой кислоты высушить и растворить в воде.

2.3. ЭТАП 2. ПЦР И АНАЛИЗ ЕЁ РЕЗУЛЬТАТОВ

Постановка ПЦР Необходимое оборудование: ДНК-амплификатор, дозаторы. Расходные материалы: микроцентрифужные пробирки на 0,5 мл, наконечники для дозаторов на 10 и 200 мкл. Реактивы: Препарат ДНК (полученный на этапе 1), Taq-полимераза и буфер к ней, вода ампульная (деионизованная), раствор нуклеотидов (2 мМ), растворы олигонуклеотидов (ITS4-TCCTCCGCTTATTGATATGC, ITS5- GGAAGTAAAAGTCGTAACAAG), минеральное масло.

Ход работы: В микроцентрифужной пробирке смешать компоненты реакции в порядке, приведённом ниже:

вода ампульная (деионизованная) 41 мкл буфер для полимеразы 10× с Mg 2+ (1–3 mM) 5 мкл нуклеотиды 2 мМ 1 мкл олигонуклеотиды от 2–20 пмоль в реакцию 2 × 1 мкл Taq-полимераза 1–3 ед. активности на реакцию 0,5 мкл ДНК-матрица (1–1000 нг) 0,5 мкл В случае, если одновременно ставится несколько реакций, целе- сообразно делать сток, содержащий все общие для всех реакций ком- поненты.

При использовании амплификатора «Терцик» в каждую пробирку добавляют 2–3 капли минерального масла. При использовании ам- плификаторов с горячей крышкой этого не требуется. После смешивания компонентов реакции пробирки необходимо поставить в амплификатор и провести реакцию по программе:

+95°^ С — 3 минуты
35 циклов (+95°^ С — 15 секунд,
+58°^ С — 30 секунд,
+72°^ С — 30 секунд)
+72°^ С — 3 минуты.

Анализ результатов ПЦР проводят методом гель-электрофореза.

Приготовление агарозного геля для разделения фрагментов ДНК Необходимое оборудование: камеры для электрофореза, источ- ники тока, дозаторы, трансиллюминатор. Расходные материалы: наконечники для дозаторов на 10 и 200 мкл. Реактивы: ТРИС ( tris (hydroxymethyl) aminomethane), борная кис- лота, 0,5 М ЭДТУ (EDTA, Ethylenediaminetetraacetic acid) (pH 8), агароза, рас т вор бромистого этидия в воде (1%), буфер для нанесения (0,025% бром феноловый синий, 0,025 ксилен цианол в 30%-ном глицерине), продукты ПЦР с предыдущей стадии работы, маркер молекулярного веса.

Ход работы:
Приготовление 5× буфера TBE.
Растворить в 0,5 л дистиллированной воды:
54 г Tris-OH
27,5 г борной кислоты (boric acid)
20 мл 0,5 M EDTA (pH 8).
Довести объём до 1 л.

Для электрофореза необходимо приготовить 0,5× буфер ТВЕ. На его основе приготовить 1%-ный агарозный гель. Для приготовления

  1. ПРАКТИЧЕСКАЯ РАБОТА

200 мл геля следует взять 20 мл 5-кратного буфера, 2 г агарозы, до- вести объём до 200 мл дистиллированной водой. Добавить 10 мкл 1%-ного раствора бромистого этидия (3,8-диамино-5-этил-6-фенил- фенантридиум бромид, EtBr, Ethidium bromide).

БРОМИСТЫЙ ЭТИДИЙ ЯВЛЯЕТСЯ СИЛЬНЫМ МУТА ГЕНОМ. ТАК ЖЕ СЧИТАЕТСЯ КАНЦЕРОГЕНОМ И ТЕРАТО ГЕНОМ. РАБОТАТЬ С НИМ И С РАСТВОРАМИ, СОДЕРЖАЩИМИ БРОМИСТЫЙ ЭТИДИЙ, СЛЕДУЕТ В НИТРИЛОВЫХ ПЕРЧАТКАХ.

Плавить гель до однородного состояния на водяной бане или в микро волновой печи, далее залить гель в электрофорезную камеру. При помощи гребёнки сформировать карманы для нанесения образ- ца необходимого объёма. После полимеризации геля заполнить каме- ру буфером (без агарозы), вытащить гребёнку. Образцы смешать с бу- фером для нанесения (5:1) и нанести в лунки. В одну из лунок нанести маркер молекулярного веса. Провести электрофорез, установив напряжение, исходя из значе- ний 2–4 вольта на сантиметр длины камеры (на небольшую камеру порядка 100 В). Об успешности разделения фрагментов можно судить по движе- нию в геле красителей, являющихся компонентами буфера для нане- сения. Когда бромфеноловый синий (более подвижный краситель) пройдёт около 2/3 длины геля, можно приступать к визуализации ДНК под воздействием ультрафиолетового света при помощи прибора трансиллюминатора.

СЛЕДУЕТ ОБРАТИТЬ ВНИМАНИЕ НА ТО, ЧТО УЛЬТРАФИОЛЕТОВЫЙ СВЕТ ВРЕДЕН ДЛЯ ЗРЕНИЯ, ПОЭТОМУ ТРАНС-ИЛЛЮМИНАТОРЫ СНАБЖЕНЫ ЗАЩИТНЫМИ ЭКРАНАМИ, КОТОРЫМИ НУЖНО ПОЛЬЗОВАТЬСЯ В ОБЯЗАТЕЛЬНОМ ПОРЯДКЕ. В КАЧЕСТВЕ АЛЬТЕРНАТИВЫ МОГУТ БЫТЬ ИСПОЛЬЗОВАНЫ СПЕЦИАЛЬНЫЕ ОЧКИ.

При освещении ультрафиолетовым светом бромистый этидий флюоресцирует оранжевым цветом, интенсивность флюоресценции увеличивается примерно в 20 раз при его связывании с ДНК (рис. 15).

Агарозный гель, окрашенный бромистым этидием..png

Рис. 15. Агарозный гель, окрашенный бромистым этидием. Визуализация ДНК ультрафиолетом

В результате описываемого эксперимента в геле должны наблю- даться фрагменты ДНК размером около 600 п. н.

2.4. ЭТАП 3. ПЦР В РЕЖИМЕ РЕАЛЬНОГО ВРЕМЕНИ (REAL-TIME PCR)

Оборудование:

  • ДНК-амплификатор для проведения ПЦР в режиме реального времени.
  • Набор микродозаторов от 1 до 200 мкл со сменными наконечниками.
  • Микроцентрифужные пробирки на 200 мкл с прозрачными крышками.
  • Источник тока и камера для проведения электрофореза в агарозном геле.

Материалы: Препарат ДНК, полученный на этапе 1. ДНК тимуса теленка или другая балластная ДНК. Taq-полимераза, буфер для Taq-полимеразы, смесь нуклеотидов (см. этап 2). Смеси праймеров и зонды для гена лектина сои: F: GCCTCTGCCGACAGTGGT R: AAGAGCTGGTTGGAACGTCTT, Probe: FAM-CAAAGATGGACCCCCACCCACG-BHQ1 Агароза, буфер ТBE 0,5×.

Ход работы:

  1. Для большей выравненности образцов в отдельной пробирке сделать общий сток компонентов реакционной смеси, за исключени- ем препарата ДНК, как указано в табл. 1. Максимально точно перенести из пробирки со стоком в отдельные пробирки по 23 мкл реакционной смеси. (Пробирки не подписывать! Надписи могут пачкать лунки ампли- фикатора, а также затруднять детекцию сигнала.)

Таблица 1

Составление реакционной смеси для ПЦР в реальном времени

Компоненты реакционной смеси×1 пробирка 25 мкл×7 пробирок 175 мкл
Вода18,8131,6
Taq-буфер ×102,5 мкл17,5
Смесь нуклеотидов 2мМ:0,5 мкл3,5
Смесь праймеров и зонда (по 5 пмоль/мкл)1 мкл7
Препарат ДНК2 мкл добавляется индивидуально
Taq-полимераза0,2 мкл1,4
  1. Приготовить разведения препарата ДНК в иммунологическом планшете или на ленте парафильма согласно табл. 2.

Таблица 2 Приготовление разведений препарата ДНК

Номерячейки NДобавить р-ра из ячейки N-1Доба-вить водыОтобрать р-ра в ячейку N+1Взять в реакциюРазбавление относительно предыдущего р-ра
12 мкл2 мкл2 мкл2 мкл×2-кратное
22 мкл2 мкл2 мкл2 мкл×2-кратное
32 мкл18 мкл2 мкл2 мкл×10-кратное
42 мкл18 мкл2 мкл2 мкл×10-кратное
52 мкл18 мкл2 мкл2 мкл×10-кратное
  1. Добавить в пробирки с реакционной смесью по 2 мкл приготов- ленного раствора ДНК. В пробирку No 6 добавить 2 мкл препарата ДНК тимуса теленка (или другую балластную ДНК), эта проба используется в качестве отрица- тельного контроля. В пробирку No 7 добавить 2 мкл воды, эту пробу используем в каче- стве контроля на наличие контаминации. (Пробирки не подписывать! Надписи могут пачкать лунки ампли- фикатора, а также затруднять детекцию сигнала.)
  2. Установить пробирки в амплификатор. Запустить амплификацию по программе: +95°^ С — 3 минуты 45 циклов (+95°^ С — 15 секунд, +60°^ С — 30 секунд, +72°^ С — 30 секунд).

Для повышения объективности имеет смысл проводить слепой контроль: установку образцов в лунки прибора и визуализацию сигнала осуществляют разные люди. Установку производят бессистемно при отсутствии исследователя, производящего визуализацию и трактовку сигнала. При этом каждый из двух исследователей заполняет таблицу (табл. 3).

Таблица 3 Форма для оценки достоверности количественного метода определения концентрации ДНК в исходном образце

No образцаNo ячейки прибораРазбавление относительно исходного образца
1×2
2×2
3×10
4×10
5×10
  1. По окончании реакции оценить значения пороговых циклов для каждого образца. Сравнить таблицу, заполненную в ходе установки пробирок в амплификатор, с таблицей, заполненной на основании значений пороговых циклов по окончанию реакции.

Проведение полуколичественного анализа

  1. Пробирки из амплификатора перенести в штатив. Смешать по 5 мкл каждого образца с 1 мкл буфера для нанесения.
  2. Провести электрофорез (см. этап 2). Для повышения объективности сделать слепой контроль: нанесе- ние образцов в лунки геля и визуализацию сигнала (оценку яркости фрагментов) осуществляют разные люди. Нанесение производят бес- системно при отсутствии исследователя, производящего визуализа- цию и трактовку сигнала. Каждый из двух исследователей заполняет таблицу (табл. 3).
  3. Сравнить таблицы. Сделать заключение о достоверности метода.

2.5. ЭТАП 4. КЛОНИРОВАНИЕ ПРОДУКТА ПЦР В ВЕКТОР PJET 1.2

Выделение ПЦР фрагмента из геля Необходимое оборудование: камеры для электрофореза, источ- ники тока, дозаторы, трансиллюминатор, центрифуга, низкотемпера- турная морозильная камера, морозильная камера на –20°С. Расходные материалы: наконечники для дозаторов на 10 и 200 мкл, микроцентрифужные пробирки на 1,5 мл, стекловата, скальпели (лез- вия или специализированные наконечники для вырезания фрагмен- тов из геля). Реактивы: буфер ТВЕ 0,5×, агароза, раствор бромистого этидия (1%), буфер для нанесения (0,025%-ный бромфеноловый синий, 0,025 ксилен цианол в 30%-ном глицерине), продукты ПЦР с предыдущей стадии работы, маркер молекулярного веса, 10 М ацетат аммония, эта- нол 96%-ный, этанол 80%-ный, ампульная вода.

Ход работ:

  1. В камере для электрофореза залить гель толщиной 5–8 мм, ис- пользовать гребёнку с шириной зубца 7–10 мм.
  2. Весь объём смеси ПЦР смешать с 5 мкл буфера для нанесения и нанести в лунку.
  3. Провести электрофорез (см. этап 2).
  4. На трансиллюминаторе расположить гель, надеть очки, непро- ницаемые для ультрафиолета, при помощи скальпеля или лезвия выре зать фрагменты геля, содержащие целевой продукт ПЦР.
  5. Кусочки геля с ДНК поместить в заранее приготовленные колон- ки, показанные на рис. 16.
  6. Убрать колонки с гелем на –70°^ С на 30–40 минут или на –20°^ С на ночь.
  7. Центрифугировать колонки при 4000–5000 об./мин в течение 5–10 минут.
  8. Раствор, оказавшийся в нижней пробирке, смешать с 0,25 объё- ма 10 М ацетата аммония, четырьмя объёмами 96%-ного этанола и по- местить на –20°^ С на 30 минут.
  9. Центрифугировать пробирки (п. 8) при 10000 об./мин в течение 15–20 минут.
  10. Слить супернатант, промыть осадки 80%-ным спиртом, высу- шить и растворить в 10 мкл воды.

 Схема колонки со стекловатой.png

Рис. 16. Схема колонки со стекловатой для выделения продукта ПЦР из агарозного геля Лигирование фрагмента в вектор pJET 1.2 Необходимое оборудование: термостат. Расходные материалы: наконечники для дозаторов на 10 и 200 мкл, микроцентрифужные пробирки на 0,5 мл. Реактивы: набор для клонирования CloneJET PCR Cloning Kit (Fer- mentas), выделенный из агарозного геля ПЦР-продукт.

Ход работы:

  1. В микроцентрифужной пробирке смешать компоненты реакции в следующей пропорции: 2× реакционный буфер 5 мкл продукт ПЦР 1 мкл вода 2,5 мкл фермент для тупления концов ДНК 0,5 мкл
  2. Инкубировать смесь 5 минут при +70°^ С, после чего поместить в лёд.
  3. Добавить по 0,5 мкл векторной ДНК и лигазы.
  4. Инкубировать смесь 15 минут при комнатной температуре.

2.6. ЭТАП 5. ТРАНСФОРМАЦИЯ БАКТЕРИЙ

Необходимое оборудование: сухотельный термостат, термостати- руемый шейкер, ламинарный бокс, спиртовка, шпатель, пенопласто- вый контейнер для льда. Расходные материалы: наконечники для дозаторов на 10 и 200 мкл, полипропиленовые пробирки на 15 мл, чашки Петри. Реактивы: химически-компетентные клетки DH5alpha, лигазная смесь, среда Luna-Bertam (LB) (твердая и жидкая), ампициллин (100 мг/мл). Состав среды LB: пептон (триптон) 10 г, дрожжевой экстракт 5 г, NaCl 5 г, довести водой до 1 л. Для твёрдой среды LB необходимо допол нительно добавить 20 г агара на 1 л среды. Среду перед исполь- зованием следует проавтоклавировать (0,1 МПа, 40 мин).

Ход работы:

  1. Достать из морозилки компетентные клетки, поместить их на ле- дяную баню на 5–10 минут.
  2. Добавить в пробирки с компетентными клетками лигазную смесь и инкубировать на льду 30 минут.
  3. Поместить пробирки в сухотельный термостат на +42°^ С на 40 се- кунд, после чего быстро перенести в лёд.
  4. Перенести содержимое микроцентрифужных пробирок в про- бирки объёмом 15 мл с 1 мл жидкой среды LB без антибиотиков.
  5. Поместить пробирки на 40 минут на термостатируемый шейкер (на +37°^ С).
  6. Подготовить в условиях ламинарного бокса чашки Петри с твёр- дой средой LB и ампициллином в концентрации 100 мг/л.
  7. Центрифугировать пробирки с культурой бактерий при 3000 об./мин в течение 3–5 минут. Слить супернатант.
  1. ПРАКТИЧЕСКАЯ РАБОТА
  2. В условиях ламинарного бокса ресуспендировать (АККУРАТНО!) бактериальные клетки в остатках среды, перенести суспензию на чашки Петри с твёрдой средой LB и аккуратно втереть при помощи шпателя.
  3. Поставить чашки Петри вверх дном в термостат на +37°^ С на ночь.

2.7. ЭТАП 6. ПЦР С КОЛОНИЙ

Необходимое оборудование: ДНК-амплификатор, дозаторы, ла- минарный бокс. Расходные материалы: микроцентрифужные пробирки на 0,5 мл, наконечники для дозаторов на 10 и 200 мкл, полипропиленовые про- бирки на 15 мл, жидкая среда LB с ампициллином 100 мг/л, сте- рильные зубочистки, пинцеты, чашки Петри с бактериальными ко- лониями. Реактивы: Taq-полимераза и буфер к ней, вода ампульная (деиони- зованная), раствор нуклеотидов (2мМ), растворы олигонуклеотидов, фланкирующих вставку в векторе (F: CGACTCACTATAGGGAGAGCGGC, R: AAGAACATCGATTTTCCATGGCAG), минеральное масло.

Ход работы:

  1. В микроцентрифужных пробирках смешать компоненты реак- ции в порядке, приведенном ниже: вода ампульная (деионизованная) 41,5 мкл буфер для полимеразы 10× с Mg 2+ (1–3 mM) 5 мкл нуклеотиды 2 мМ 1 мкл олигонуклеотиды 2–5 пмоль в реакцию 2 × 1 мкл Taq-полимераза 1–3 ед. активности на реакцию 0,5 мкл
  2. В условиях ламинарного бокса подготовить пробирки объёмом 15 мл. Добавить в каждую пробирку по 3 мл среды LB с ампициллином, количество пробирок со средой должно равняться количеству проби- рок с ПЦР-смесью.
  3. Расположить перед собой чашку Петри с колониями, штатив с про- бирками, содержащими ПЦР-смесь, штатив с пробирками со средой.
  4. Стерильной зубочисткой, удерживаемой пинцетом, коснуться колонии бактерий, окунуть зубочистку в ПЦР-смесь, затем бросить её в пробирку со средой. (Зубочистки стерилизуют предварительно автоклавированием.)
  5. Повторить процедуру с оставшимися колониями. При использовании амплификатора «Терцик» в каждую пробирку с ПЦР-смесью добавляют 2–3 капли минерального масла. При исполь- зовании амплификаторов с горячей крышкой этого не требуется.
  6. Далее пробирки необходимо поставить в амплификатор и про- вести реакцию по программе: +95°^ С — 5 минут 25 циклов (+95°^ С — 15 секунд, +58°^ С — 30 секунд, +72°^ С — 30 секунд) +72°^ С — 5 минут.
  7. Пробирки с зубочистками в среде LB поместить в термостатируе- мый шейкер на +37°^ С, 130 об./мин на ночь.
  8. Анализ результатов ПЦР проводят методом гель-электрофореза (см. этап 2). Ожидаемый размер продуктов ПЦР 650–700 п. н. Наличие такого продукта говорит об успешности клонирования.

2.8. ЭТАП 7. ВЫДЕЛЕНИЕ ПЛАЗМИДНОЙ ДНК

Необходимое оборудование: центрифуги, дозаторы, pH-метр. Расходные материалы: полипропиленовые пробирки на 10–15 мл, микроцентрифужные пробирки на 1,5 мл, наконечники для дозаторов на 1 мл, 200 мкл. Реактивы: раствор 1 (глюкоза 50 мМ, трис HCl 25мМ, ЭДТА 10мМ), раствор 2 (NaOH 0,2 N, SDS 1%), раствор 3 (3М ацетат калия, pH 5,2; для приготовления данного рас- твора следует растворить необходимое количество ацетата калия в воде до достижения приблизительно 2/3 окончательного объёма рас- твора, после чего довести pH концентрированной уксусной кислотой), этанол 70%, хлороформ, изопропанол, культура бактерий.

Ход работы:

  1. Пробирки с ночными культурами бактерий центрифугировать 10 ми нут при 3000 об./мин для осаждения клеток.
  2. Слить супернатант как можно полнее.
  3. Ресуспендировать клетки в 200 мкл раствора 1, перенести су- спензию в микроцентрифужную пробирку объёмом 1,5 мл.
  4. Добавить 400 мкл раствора 2, перемешать содержимое перево- рачиванием пробирки, подождать 2–3 минуты. Раствор должен стать вязким и просветлиться.
  5. Добавить 300 мкл раствора 3, перемешать. Должны выпасть дена турированные белки в виде белых хлопьев.
  6. Центрифугировать 10 минут при 10000 об./мин.
  7. Супернатант перенести в чистую пробирку, добавить равный объём хлороформа, плавно перемешивать в течение 15–20 минут.
  8. Центрифугировать 5 минут при 10000 об./мин. Верхнюю фрак- цию перенести в чистую пробирку, добавить 2/3 объёма изопропано- ла, осторожно перемешать. Инкубировать на холоде 20 минут.
  9. Центрифугировать 15 минут при 10000 об./мин.
  10. Слить супернатант, промыть осадок 70%-ным этанолом, высу- шить, растворить в 20–40 мкл воды.

2.9. ЭТАП 8. РЕСТРИКЦИЯ ПЛАЗМИДНОЙ ДНК

Необходимое оборудование: сухотельный термостат, дозаторы. Расходные материалы: наконечники для дозаторов на 10 и 200 мкл, микроцентрифужные пробирки на 0,5 мл. Реактивы: раствор плазмиды (см. этап 7), рестриктазы XhoI и XbaI (Ferments), буфер Tango 2×, ампульная вода.

Ход работы: Поскольку ДНК-вставка была залигирована в вектор по тупым кон- цам, вырезать ее можно только путём двойной рестрикции. Для этого надо использовать рестриктазы, сайты которых располагаются с раз- ных сторон от места встройки нашего продукта. Рассмотрим карту вектора (рис. 17).

Карта вектора pJET 1.2.png

Рис. 17. Карта вектора pJET 1.2

Примерами таких рестриктаз являются XhoI и XbaI. Для проведения рестрикции требуется смешать в пробирке компо- ненты реакции в следующей пропорции: вода 12 мкл буфер 2 мкл препарат ДНК 5 мкл рестриктаза XhoI 0,5 мкл рестриктаза XbaI 0,5 мкл Инкубировать 1 час при +37°^ С. По окончании рестрикции провести электрофоретическое разде- ление ее продуктов (см. этап 2). Присутствие на электрофореграмме фрагмента ДНК длиной около 600 п. н. свидетельствует о наличии в век- торе целевой вставки.

2.10. ЭТАП 9. СЕКВЕНИРОВАНИЕ

Необходимое оборудование: ДНК-амплификатор c горячей крыш- кой, ДНК-секвенатор MEGABACE 1000 (или аналогичный), центрифуга с охлаждением, укомплектованная ротором для 96-луночных планше- тов, дозаторы. Расходные материалы: планшеты 96-луночные для MEGABACE, на- конечники для дозаторов на 10 и 200 мкл. Реактивы: Препарат плазмидной ДНК (полученный на этапе 7), Taq-полимераза и буфер к ней, вода ампульная (деионизованная), ра- створ нуклеотидов (40–200 мкМ), растворы олигонуклеотидов pJET (F:CGACTCACTATAGGGAGAGCGGC, R: AAGAACATCGATTTTCCATGGCAG), минеральное масло, 10М ацетат аммония, спирт 96%-ный, спирт 80%-ный, набор для секвенирования, матрица для секвенатора.

Ход работы: Пробоподготовка. Секвенировать можно как плазмидную ДНК, так и продукты ПЦР. Вместе с тем отмечено, что сиквенсы получаются лучше при использо- вании в качестве матрицы продукта ПЦР, полученного в результате ам- плификации фрагмента плазмиды (в течение 15–20 циклов). По этой причине есть смысл провести ПЦР на имеющихся у нас препаратах плазмидной ДНК как необходимый этап пробоподготовки к секвени- рованию. Для этого компоненты реакции смешивают в следующей пропорции:

вода ампульная (деионизованная) 41 мкл буфер для полимеразы 10× с Mg 2+ (1–3 mM) 5 мкл нуклеотиды 2 мМ 1 мкл олигонуклеотиды 2–5 пмоль в реакцию 2 × 1 мкл Taq-полимераза 1–3 ед. активности на реакцию 0,5 мкл ДНК-матрица 0,5 мкл

В случае, если одновременно ставится несколько реакций, целе- сообразно делать сток, содержащий все общие для всех реакций компонен ты.

Поставить пробирки в амплификатор и провести реакцию по про- грамме: +95°^ С — 5 минут 15 циклов (+95°^ С — 15 секунд, +58°^ С — 30 секунд, +72°^ С — 30 секунд) +72°^ С — 5 минут.

После проведения реакции продукты очистить переосаждением этанолом с ацетатом аммония (как описано на этапе 4). Для секвенирования важным параметром считается точность определения концентрации ДНК-матрицы. Удобнее всего оценивать концентрацию ДНК на основании сравнения свечения в ультрафио- летовом свете электрофоретически разделённых исследуемых фраг- ментов с различными разведениями маркерной ДНК известной кон- центрации. Данный метод хорош тем, что является достаточно точным для определения концентрации ДНК, а также позволяет убедиться в отсутствии нецелевых фрагментов и существенной для сиквенса де- градации ДНК.

Постановка реакции секвенирования В каждой лунке планшета смешать компоненты реакции секвени- рования в следующей пропорции:

ДНК-матрица (5–20 нг) 1 мкл реакционная смесь (из набора) 2 мкл праймер (5 пмоль/мкл) 1 мкл вода 1 мкл Заклеить планшет плёнкой, поставить в амплификатор и провести реакцию по программе: 35 циклов (+95°^ С — 15 секунд, +55°^ С — 15 секунд, +60°^ С — 1 минута). По окончании программы добавить в каждую лунку по 1 мкл 10 М ацетата аммония и 18 мкл 96%-ного спирта. Оставить на 30 минут при –20°^ С. Центрифугировать 40 минут при 3700 об./мин.

Слить супернатант (удобнее отбирать его многоканальным до- затором), промыть осадки 100 мкл 80%-ного этанола, высушить, рас- творить в буфере для нанесения, прилагаемом к набору для секвени- рования. Запустить секвенатор MEGA BACE по инструкции к прибору. Про- чтение сиквенсов секвенатор осуществляет в автоматическом ре- жиме. По окончании анализа следует только скопировать файлы с резуль татами.

2.11. ЭТАП 10. АНАЛИЗ СИКВЕНСОВ

Анализ сиквенсов можно осуществить при помощи алгоритма BLAST, доступного на сайте NCBI (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Для этого надо выбрать функцию nucleotide blast. В результате от- кроется окно, показанное на рис.18.

Вид интернет-страницы «Basic Local Alignment Search Tool».png

Рис. 18. Вид интернет-страницы «Basic Local Alignment Search Tool» на сайте http://blast.ncbi.nlm.nih.gov/Blast.cgi

В этом окне в область, указанную стрелкой 1, надо вставить сик- венс в текстовом формате, поставить метку, где указывает стрелка 2, нажать кнопку BLAST, на которую указывает стрелка 3. После чего откроется окно, в котором будут представлены вырав- нивания введённого сиквенса относительно наиболее близких сик- венсов из базы данных. Результаты будут представлены в виде, пока- занном на рис. 19.

Выравнивание анализируемого сиквенса относительно имеющегося в базе NCBI.png

Рис. 19. Выравнивание анализируемого сиквенса относительно имеющегося в базе NCBI

Проанализировав несколько десятков сиквенсов отдельных кло- нов, можно составить достаточно полное представление о том, какие компоненты были добавлены в мясной фарш.

2.12. ПРЕДСТАВЛЕНИЕ РЕЗУЛЬТАТОВ РАБОТЫ

Для закрепления полученных знаний по окончании эксперимента имеет смысл подготовить отчёт о проделанной работе. Отчёт должен включать следующие разделы: введение, материал и методы, результаты и обсуждение, заключение. В разделе «Введение» необходимо сформулировать цели работы. В разделе «Материал и методы» следует подробно описать методики, которые были освоены в ходе практикума, в разделе «Результаты и об- суждение» нужно отразить, какие результаты были получены на раз- ных этапах работы и как они соотносятся с основной задачей исследо- вания. При обсуждении результатов рекомендуется учитывать данные, полученные группой студентов, проходивших практику, а не отдель- ными студентами.

ЗАКЛЮЧЕНИЕ

Таким образом, в ходе эксперимента, описанного в данном руко- водстве, можно освоить основные методы генной инженерии для реше ния простой и понятной задачи — выяснения состава мясных полу фабрикатов. Вывод о наличии сои можно сделать на основе ре- зультатов ПЦР в реальном времени. Сиквенсы таксономически значи- мого района (ITS1-ген 5,8S РНК-ITS2), полученные из разных клонов, соответствуют продуктам ПЦР, полученным на ДНК разных видов, име- ющихся в смеси. Анализ сиквенсов из нескольких десятков клонов може т дать достаточно много информации о том, какие биологиче- ские объекты присутствовали в смеси. В мясном фарше нам удавалось найти лук, батат, горчицу, фитопатогенные грибы и др.

РЕКОМЕНДУЕМАЯ ЛИТЕРАТУРА

  • Глик Б., Пастернак Дж. Молекулярная биотехнология. Принципы и применение. М.: Мир, 2002. 589 с.
  • Жимулев И. Ф. Общая и молекулярная генетика. Новосибирск: Изд-во Новосиб. ун-та, 2002. 458 с.
  • Рыбчин В. Н. Основы генетической инженерии. Изд. 2-е, перераб. и доп. СПб : Изд-во СПбГУ, 2002. 525 с.
  • Щелкунов С. Н. Генетическая инженерия. Новосибирск: Изд-во Новосиб. ун-та, 2008. 496 с.
  • Sambrook J., Russell D. Molecular Cloning: A Laboratory Manual (3rd Edition) / CSH Press. 2001. ISBN: 0879695773. 2222 p.

ПРИГОТОВЛЕНИЕ ХИМИЧЕСКИ КОМПЕТЕНТНЫХ КЛЕТОК E. COLI

(H. Inoue, H. Nojima, H. Okayama, “High efficiency transformation of Escherichia coli with plasmids”, Gene, 96(1990), 23–8)

Рассеять бактерии штрихом на чашку с селективной средой, вы- ращивать при +37°^ С в течение ночи, несколько колоний (10–12) диа- метром ~2–3 мм поместить в 100 мл среды LB в колбе объёмом 1 л, инкубировать при 18°^ С и интенсивном встряхивании (200–300 rpm), растить до OD(600) = 0,6. Все дальнейшие манипуляции проводить на холоде. Охладить су- спензию клеток в ледяной бане в течение 10–15 минут, центрифуги- ровать 10 минут при 2000–3000 об./мин, тщательно слить суперна- тант, суспензировать в 40 мл буфера TB; центрифугировать 10 минут при 2000–3000 об./мин, тщательно слить супернатант, суспензиро- вать в 10 мл TB с DMSO 7%; повторить последний шаг, разаликвотить по 100 мкл в охлаждённые микроцентрифужные пробирки, заморо- зить в жидком азоте, хранить в жидком азоте (лучше) или на –70°^ С. Состав буфера ТВ: PIPES 10 mM MnCl 2 55 mM CaCl 2 15 mM KCl 250 mM

ПРИЛОЖЕНИЕ

РОССИЙСКИЕ КОМПАНИИ, РЕАЛИЗУЮЩИЕ ОБОРУДОВАНИЕ И РАСХОДНЫЕ МАТЕРИАЛЫ ДЛЯ ГЕННО-ИНЖЕНЕРНЫХ ЭКСПЕРИМЕНТОВ

Подробную информацию о компаниях, реализующих товары и услуги для генной инженерии, можно найти на сайте http://molbiol.ru/ Обобщённый список основных расходных материалов и фирм, где можно их приобрести, представлен в таблице:

Файлы

методичка.pdf