Стандартные олигонуклеотиды

Мы предлагаем стандартные олигонуклеотиды по цене 200 рублей за 100мкл 100mM раствора

 Random hexamer (dN)6 NNNNNN 
 Oligo (dT)23  TTTTTTTTTTTTTTTTTTTTTTT
 Oligo (dT)18  TTTTTTTTTTTTTTTTTT
 Oligo (dT)13  TTTTTTTTTTTTT
 M13F (-20) 18-mer   GTAAAACGACGGCCAGTG
 M13F (-40)   GTTTTCCCAGTCACGAC
 M13R (-48) 20-mer  AGCGGATAACAATTTCACAC
 M13R (-27) 19-mer  GGAAACAGCTATGACCATG
 M13rev 20-mer   TCACACAGGAAACAGCTATGAC
 T7 20-mer   TAATACGACTCACTATAGGG
 T7 Terminator  GCTAGTTATTGCTCAGCGG
 T3  ATTAACCCTCACTAAAG
 SP6  ATTTAGGTGACACTATAGAATAC
 SP6 Sequencing Primer (15 mer)   CACATACGATTTAGG
 Lambda gt 11 forward (24-mer)   GGTGGCGACGACTCCTGGAGCCCG
 Lambda gt 11 reverse (24-mer)   TTGACACCAGACCAACTGGTAATG
 AOX1 Forward   GACTGGTTCCAATTGACAAGC
 AOX1 Reverse    GCAAATGGCATTCTGACATCC

Доставка

Доставка по Санкт-Петербургу осуществляется БЕСПЛАТНО.
Доставка по России при заказе от 8 олигонуклеотидов БЕСПЛАТНО.

Для уточнения цены доставки по странам СНГ и России при заказе менее 8 олигонуклеотидов свяжитесь с нами по электронной почте или по телефонам, указанным в разделе Контакты.

Есть вопросы? Оставьте телефон, мы Вам перезвоним!

Отправляя форму, Вы даёте своё согласие на обработку персональных данных

Последние события

загружаю

Свяжитесь с нами

Политика конфиденциальности

Санкт-Петербург16-02-2018