Синтез олигонуклеотидов

  • Услуги
  • Синтез олигонуклеотидов

Компания “Бигль” предлагает синтезировать олигонуклеотиды для Ваших научных и прикладных задач. Мы - единственная компания в России, которая оставляет за своими клиентами выбор синтезатора, на котором будет выполнен Ваш заказ. В нашем распоряжении находятся автоматические синтезаторы нуклеиновых кислот ASM - 800, ASM - 2000. Мы используем только высококачественные реактивы ведущих западных компаний, что гарантирует высочайшую точность и стабильный выход синтеза.

Олигонуклеотиды с масштабом синтеза до 20 О.Е. очищаются с помощью электрофореза в полиакриламидном геле, свыше 20 О.Е. – с помощью обращенно-фазовой высокоэффективной жидкостной хроматографии. 

По Вашему желанию мы можем провести очистку олигонуклеотидов с помощью обращенно-фазовой высокоэффективной жидкостной хроматографии (ВЭЖХ) при любом масштабе синтеза.
Мы можем предложить экспресс-синтез: в течение 1 рабочего дня мы синтезируем олигонуклеотиды и предоставляем в виде водного раствора, прошедшего упрощённую систему очистки. 

Высокое качество наших олигонуклеотидов подтверждено нашими заказчиками – ведущими научными учреждениями биологического и медицинского профиля.

При длине олигонуклеотида от 50 до 100 оснований цена на синтез увеличивается на 10%. Если Вам необходим олигонуклеотид, длина которого превышает 100 оснований, пожалуйста, свяжитесь с нами

Время исполнения заказа от 2 до 5 рабочих дней.

  • Пожелания к оформлению заказа

    Уважаемые коллеги,

    Мы будем рады выполнить любой Ваш заказ на синтез олигонуклеотидов. А чтобы сделать наше взаимодействие более эффективным, просим Вас придерживаться нескольких несложных правил при формировании заказа.

    Помните, что короткие названия (до 8 символов) лучше размещаются на этикетке и легче читаются. При этом порядковые номера (1, 2, 3…) – это не самый удачный вариант названия, особенно если в Ваших разных заказах разные праймеры имеют один и тот же номер.

    1. Не забывайте давать названия каждому из Ваших праймеров. 
    2. Последовательность праймера принято писать от 5’ к 3’ концу. Если Вы придерживаетесь этого правила, то дополнительно обозначать 5’ и 3’ концы не обязательно.
    3. Набирая последовательность праймера, пожалуйста, обращайте внимание на раскладку клавиатуры. Старайтесь не вставлять символы, набранные кириллицей в последовательность из латинских букв. Менять регистр для C и G не обязательно.
    4. Внутрь последовательности праймера лучше не вставлять символы, не имеющие непосредственного отношения к ней.
    5. Если Вам нужен модифицированный олигонуклеотид, указывайте названия модификаций и их положение.
    6. Помните, что последовательности праймеров с большим количеством повторов и вторичных структур хуже работают и синтезируются с более низким выходом.

    Пример оформления заявки на праймеры:

    Название Последовательность


    Название 5’ модификация   3’ модификация

    Задержек с доставкой праймеров не будет, если в своем заказе Вы укажете свой действующий контактный телефон и адрес доставки, по которому Вас (или Ваших коллег) можно застать в рабочее время.

  • Очистка

    Мы поставляем олигонуклеотиды полностью готовыми для самых сложных молекулярно-генетических и биохимических приложений. Благодаря оригинальной системе подготовки и очистки наши олигонуклеотиды обладают повышенной активностью в ферментативных реакциях и являются свободными от токсичных ионов и растворителей.

    Мы гарантируем отсутствие загрязнений нецелевыми фрагментами ДНК, в том числе, плазмидной ДНК, ДНК человека и т.д. 

    Наши олигонуклеотиды деблокированы, очищены с помощью гель-электрофореза или обращенно-фазовой высоко эффективной жидкостной хроматографии (ВЭЖХ). Олигонуклеотиды с масштабом синтеза до 20 О.Е. очищаются с помощью электрофореза в полиакриламидном геле, свыше 20 О.Е. – с помощью ВЭЖХ или на RP картриджах с применением специализированного оборудования  OPS-201. 

    По Вашему желанию мы можем провести очистку олигонуклеотидов с помощью ВЭЖХ при любом масштабе синтеза с применением специализированного оборудования.  На завершающем этапе мы проводим стадию обязательного контроля качества, включающую оценку прозрачности, отсутствие взвеси в растворе и т.п., контроль чистоты и длины целевого олигонуклеотида на ПААГ, спектрофотометрический анализ, вычисление концентрации. 

    Мы поставляем олигонуклеотиды по Вашему желанию в виде раствора (milliQ H2O) или в лиофилизованном виде.

  • Экспресс-синтез

    Если Вы ограничены во времени, мы можем предложить экспресс-синтез: в течение одного рабочего дня мы синтезируем олигонуклеотиды и предоставляем их в виде водного раствора, прошедшего упрощённую систему очистки. Такие олигонуклеотиды полностью подходят для большинства рутинных применений, например, ПЦР. 

    В нашем предложении "Экспресс-синтез" совмещена невероятная оперативность синтеза и более привлекательная по сравнению со стандартными способами подготовки олигонуклеотидов цена. 

    С ценой предложения Вы можете ознакомиться в разделе Цены.

    О возможности выбора оптимальных способов очистки для Ваших задач Вы можете проконсультироваться у нас по электронной почте или по телефонам, указанным в разделе Контакты.  

  • Стандартные олигонуклеотиды

    Мы предлагаем стандартные олигонуклеотиды по цене 200 рублей за 100мкл 100mM раствора

     Random hexamer (dN)6 NNNNNN 
     Oligo (dT)13  TTTTTTTTTTTTT
     M13F (-20) 18-mer   GTAAAACGACGGCCAGTG
     M13R (-48) 20-mer  AGCGGATAACAATTTCACAC
     M13R (-27) 19-mer  GGAAACAGCTATGACCATG
     SP6 Sequencing Primer (15 mer)   CACATACGATTTAGG
     Lambda gt 11 forward (24-mer)   GGTGGCGACGACTCCTGGAGCCCG
     Lambda gt 11 reverse (24-mer)   TTGACACCAGACCAACTGGTAATG
  • Синтез сверхдлинных олигонуклеотидов

    Нашей компанией разработан оригинальный способ синтеза сверхдлинных олигонуклеотидов. Мы предлагаем услугу по синтезу олигонуклеотидов длиной 200 оснований и более. Для уточнения цены заказа контактируйте с нами.

  • Цены

    Компания “Бигль” предлагает синтезировать олигонуклеотиды для Ваших научных и прикладных задач. Мы - единственная компания в России, которая оставляет за своими клиентами выбор синтезатора, на котором будет выполнен Ваш заказ. В нашем распоряжении находятся новейшие автоматические синтезаторы ASM - 800 (Россия) и синтезатор производства Applied Biosystems. Мы используем только высококачественные реактивы ведущих западных компаний, что гарантирует высочайшую точность и стабильный выход синтеза.

    Олигонуклеотиды с масштабом синтеза до 20 О.Е. очищаются с помощью электрофореза в полиакриламидном геле, свыше 20 О.Е. – с помощью обращенно-фазовой высокоэффективной жидкостной хроматографии. 

    По Вашему желанию мы можем провести очистку олигонуклеотидов с помощью обращенно-фазовой высокоэффективной жидкостной хроматографии (ВЭЖХ) при любом масштабе синтеза.
    Мы можем предложить экспресс-синтез: в течение 1 рабочего дня мы синтезируем олигонуклеотиды и предоставляем в виде водного раствора, прошедшего упрощённую систему очистки. 

    Высокое качество наших олигонуклеотидов подтверждено нашими заказчиками – ведущими научными учреждениями биологического и медицинского профиля.

    При длине олигонуклеотида от 50 до 100 оснований цена на синтез увеличивается на 10%. Если Вам необходим олигонуклеотид, длина которого превышает 100 оснований, пожалуйста, свяжитесь с нами

    Время исполнения заказа от 2 до 5 рабочих дней.

    Шкала синтеза,
    Гарантированное количество При проведении синтеза на синтезаторе ASM-800
    цена (руб./шаг)
    При проведении синтеза на синтезаторе
    Applied Biosystems
    цена (руб./шаг)
    Мкмоль Оптических единиц
    0,02 0,01 2 16 20 ПААГ*
    0,05 0,025 5 20 24 ПААГ
    0,1 0,05 10 30 32 ПААГ
    0,2 0,1 20 45 50 ВЭЖХ**
    0,5 0,25 50 80 100 ВЭЖХ
    1,0 0,5 100 150 190 ВЭЖХ
    2,0 1,0 200 270 300 ВЭЖХ
    3,0 1,5 300 400 490 ВЭЖХ
    4,0 2,0 400 500 600 ВЭЖХ
    5,0 2,5 500 600 710 ВЭЖХ


Доставка по Санкт-Петербургу осуществляется БЕСПЛАТНО.
Доставка по России при заказе от 8 олигонуклеотидов БЕСПЛАТНО.

Для уточнения цены доставки по странам СНГ и России при заказе менее 8 олигонуклеотидов свяжитесь с нами по электронной почте или по телефонам, указанным в разделе Контакты.

Есть вопросы? Оставьте телефон, мы Вам перезвоним!

Отправляя форму, Вы даёте своё согласие на обработку персональных данных

Последние события


Свяжитесь с нами

Политика конфиденциальности
